Rapid communication: Single nucleotide polymorphisms detected in exon 10 of the bovine growth hormone receptor gene.

نویسندگان

  • W Ge
  • M E Davis
  • H C Hines
  • K M Irvin
چکیده

Source and Description of Primers. Primers GHRE102′Fgc and GHRE102′R were designed based on the cDNA sequence of the bovine growth hormone receptor (GHR) gene (Hauser et al., 1990) and the genomic DNA sequence of the human GHR gene (Godowski et al., 1989). Primers GHRE10F and GHRE10R were designed based on our own sequence of the fragment amplified using the first pair of primers. Primer Sequences. GHRE102′Fgc: 5′ GCGTAGCTACTCAACTCATCAAACTGCCCATAC 3′; GHRE102′R: 5′ AGCCAACCCTGTGCCATTCAA 3′; GHRE10F: 5′ CACTTACTTCTGCGAGGTATAGGC 3′; GHRE10R: 5′ TCAAAGAGAGTAGCACACCGATA 3′. Method of Detection. A 528-bp fragment was amplified from genomic DNA by PCR using primers GHRE102′Fgc and GHRE102′R and electrophoresed on a denaturing gradient polyacrylamide gel as described earlier (Ge et al., 1999). Two alleles with three genotypes were identified by denaturing gradient gel electrophoresis (DGGE) analyses. DNA fragments amplified from individuals of the two homozygous genotypes were sequenced and four single nucleotide polymorphisms (SNP) were identified by aligning the sequences (GenBank accession number: AF140284). The SNP were verified by the PCR-RFLP method. They were at positions 76 (T → C), 200 (G → A), 229 (T → C), and 257 (A → G) bp from the 5′ end of the fragment. Only the SNP at position 229 is involved in producing the DGGE polymorphism reported earlier (Ge et al., 1999), with the T allele corresponding to the B allele of DGGE. Description of Polymorphism. The PCR products using primers GHRE102′Fgc and GHRE102′R were digested with MaeII (Boehringer Mannheim, Indianapolis, IN), which recognizes the C alleles at positions 76 and 229 bp. Primer GHRE10F introduced a NarI (Promega, Madison, WI) recognition site that recognizes the G allele at 200 bp. The PCR conditions using primers

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Novel Single Nucleotide Polymorphisms (SNPs) in Intron 2 and Exon 3 Regions of Leptin Gene in Sumba Ongole Cattle

The bovine leptin (LEP) gene was widely used as a candidate gene for molecular selection to improve productivity traits of cattle. This study was carried out to identify single nucleotide polymorphisms (SNPs) in the LEP gene of Sumba Ongole (SO, Bos indicus) cows using sequencing method. A total of 31 animals were used in this study for analyses. Research showed that total of 16 SNPs w...

متن کامل

Association of Prolactin and Prolactin Receptor Gene Polymorphisms with Economic Traits in Breeder Hens of Indigenous Chickens of Mazandaran Province

Polymorphisms in 5’-flanking region of prolactin (PRL), exon 2 and exon 5 of prolactin receptor (PRLR) genesand its association with growth and egg traits were examined in breeder hens of Mazandaran native fowlsbreeding station. A single nucleotide polymorphism at site C-2402T and a 24 bp nucleotide sequence insertionat situation -382 in 5’-flanking regions of PRL gene were id...

متن کامل

Single Nucleotide Polymorphism Analysis of the Bone Morphogenetic Protein Receptor IB and Growth and Differentiation Factor 9 Genes in Rayini Goats (Capra hircus)

The FecB, a mutation in the bone morphogenetic protein receptor IB (BMPR-IB) gene, which increases the fecundity of Booroola Merino sheep, and FecGH, a mutation in the Growth and Differentiation Factor 9 (GDF9), which affects the fecundity of Cambridge and Belclare sheep in a dose sensitive manner, were analyzed as candidate genes associated with the prolificacy in Rayini goats. These polymorph...

متن کامل

Single Nucleotide Polymorphisms (SNPs) of GDF9 Gene in Bahmaei and Lak Ghashghaei Sheep Breeds and Its Association with Litter Size

Growth differentiation factor 9 (GDF9) belong to the superfamily of transforming growth factor β that is highly expressed in growing ovarian follicles of oocyte, and it has been strongly related to fecundity traits in sheep. Therefore, the GDF9 gene could serve as a genetic marker for improvement of reproductive performance in sheep. Therefore, the aim of this study was to invest...

متن کامل

Association of TG-repeats in the 5’-flanking region of bovine growth hormone receptor (GHR) gene with milk production traits and somatic cell count in Holstein cattle

The growth hormone receptor (GHR) is a member of cytokine/hematopoietin family that mediates the biological actions of growth hormone (GH) on target tissues. Therefore, the purpose of this study was to examine the association of TG-repeat polymorphisms in the 5’-flanking region of bovine GHR gene with milk production traits and somatic cell score (SCS) in Holstein cattle of Iran. The part of 5’...

متن کامل

Study of Dopamine Receptor Gene Polymorphisms and Their Association with Growth and Egg Production Traits in West Azerbaijan Native Chicken

The objective of this study was to search for single nucleotide polymorphism (SNP)-type polymorphisms in the dopamine D1 receptor in West Azerbaijani native chicken and look for their association with egg production and body weight traits of chickens by polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP). For this purpose 180 blood samples were taken from nativ...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Journal of animal science

دوره 78 8  شماره 

صفحات  -

تاریخ انتشار 2000