Rapid communication: Single nucleotide polymorphisms detected in exon 10 of the bovine growth hormone receptor gene.

Source and Description of Primers. Primers GHRE102′Fgc and GHRE102′R were designed based on the cDNA sequence of the bovine growth hormone receptor (GHR) gene (Hauser et al., 1990) and the genomic DNA sequence of the human GHR gene (Godowski et al., 1989). Primers GHRE10F and GHRE10R were designed based on our own sequence of the fragment amplified using the first pair of primers. Primer Sequences. GHRE102′Fgc: 5′ GCGTAGCTACTCAACTCATCAAACTGCCCATAC 3′; GHRE102′R: 5′ AGCCAACCCTGTGCCATTCAA 3′; GHRE10F: 5′ CACTTACTTCTGCGAGGTATAGGC 3′; GHRE10R: 5′ TCAAAGAGAGTAGCACACCGATA 3′. Method of Detection. A 528-bp fragment was amplified from genomic DNA by PCR using primers GHRE102′Fgc and GHRE102′R and electrophoresed on a denaturing gradient polyacrylamide gel as described earlier (Ge et al., 1999). Two alleles with three genotypes were identified by denaturing gradient gel electrophoresis (DGGE) analyses. DNA fragments amplified from individuals of the two homozygous genotypes were sequenced and four single nucleotide polymorphisms (SNP) were identified by aligning the sequences (GenBank accession number: AF140284). The SNP were verified by the PCR-RFLP method. They were at positions 76 (T → C), 200 (G → A), 229 (T → C), and 257 (A → G) bp from the 5′ end of the fragment. Only the SNP at position 229 is involved in producing the DGGE polymorphism reported earlier (Ge et al., 1999), with the T allele corresponding to the B allele of DGGE. Description of Polymorphism. The PCR products using primers GHRE102′Fgc and GHRE102′R were digested with MaeII (Boehringer Mannheim, Indianapolis, IN), which recognizes the C alleles at positions 76 and 229 bp. Primer GHRE10F introduced a NarI (Promega, Madison, WI) recognition site that recognizes the G allele at 200 bp. The PCR conditions using primers